Full Breast Digital Mammography Light #54422219ab4fc80cabcb32ed

DNA Sequence


GGACTGAAGCCGCCGTCCGTACCGGCTCCTCTACCATTATAGGCAATCCAGTAGTAACTACGTGTCGTTGCTTGATCTTTAGCAAATGTACATTGGGGGAGTTGTCAATGGGTCAGCACTGTGGAGTATGATGTAGATGGTCGCGGAGGGAAAGCGTCAATGCCGCACGACGTCTATCAATATACAGGCGTCTAGCGCGGAGGTTACCAAGGAACATCACGGGCGTCGCCACCCCAAATTCCACCCTGGAAGATAAAGCCATATGCTCTTGGGCCCAAGTATGTTTGTACACGGAATAAAAGACGGATGTTAGAGAGATGCATGGTTCGGGGCGCGGACCACGACAGATTTCTTTTACCAGCTTACACAGTACCGCGCGATGGTATTCAACACCAGAGAAGGTCTACTGGTCGCTCCAGAGCCACTCGATCTGCGGGTGTCTCCGCATCAGTTCATGCAACGATGATATAAGTGGACTGTACGCGCGCTAGCTGTCTCGCTTATTCAGTCTAATCAAATAAGGAGACCGTGTGCGATACGGCACGGAGTTTTCAGTCTTGTGTCTAGCTCTACATTAGAAGCCTTAGCGTCTGCAACCCGAGTACGCTTTGGAACCGAAAAGATTGAGATCATCTGCGGTAGGGCGAACGTACACTAGCACTTGGCACAACGCTCGGTGCTCCGAGAGCCTCGCTAGAAAAATTGACCTCCGTTGTTTTTAATGATGGGCCTAAAGTTGTAACGGGGGACCCTGCGTGCAGAGCGGAGCCGAACGATCGAGCAGAATGATTTTGCTATACCATTAGTCCGGCGGTTCGAGCCACCTAGTCAACCGCTTCTTTTTTGATTCCTACAAGAACAAGCGCGGGAAGTTACGAGCCTCCAGCATGTTCTGCAACCACCTATCTATCAACTGTTGTGCGAAACGCCAACTGTGATAATGCGCAGGTCGAGCAGGATGTATATCGACCAGCGCGAACTGATGTACATCGGTTCTAAGCAGCAATAGTATGGGTAAAGGCGATAGGATTACAGGTACTCTCCGAATCCCTCATCTCGGAGGACACATCGATACGCGCAGTGCGACTGGCTGATGGAAATGCGCGCGGTTTTCTCGCTGCATAGGATATTGGGTCCCATACTAAACTTCAGAAAGCATTTGGCACGGTGCCCAAACACGGCCGAGAGCGACAGCATTTCAGTGTATCGAGCGAGAGTTAGGGCGCGCCGCGGGGGTTACCATCGACCCCCTTAACACATCAAACACTGCTAGTACAAATGAAGAAGGCTTATGAGAAACTAGACTCATAATCTCTCAGACCCGTTTAGGTATGGGACTCCACGAATAAGTACTACTGGGGGCGTCTGGCTTCATGGCGCCAGGTGCGGTCGTACTTTTATGTAGGCGCCTGTGTTGCCATTAGTGTTTTGCACTTTGAGATGACAAATACTACATTCCTACCGGAATCGTGGTGTAACGCAGGTTAGTGCTTGAAGCCGGGCAGGCGCATTAGTGGTGACCGGGACAGCTAACGTTAGGAACACGAGAAAGCCAAGAGGCTTGGCACTAGGGCACATCATCTGTATGTTACCAGCCGATACTATATTAACTTCAAAACTATGAGAAGTTATTTCTCGGGATAAAAACAATGAATGAAAGGGGCCAAAGGACCGACAAACTGGATCGCGCAGTCTGGATCCTCGAAGACAATCGTACCTGATAGAATCGATGCGTAATTGGCTTTTGGTAACAGGATCGCGTTTCACGTTCTGCTCAATCCCGTAACCTCAAGAGTTAGGAGCGATCTGTTCAGTGGAAGCCTGCCCCCCATCGACTTCTAAAACCCTCAAGGGGTGCATATTGTCGGTAAGAGGACCCCCGAGGTTGAACCTAGAGACACTGTAACTATTGTCTTCCAGAATCCGGTGTTGCGGACCTGTCGTTTACGGGAACAGCTGATAATGGTCGATCGCTCTAACGCCATGCCGAGCTAATCTATGGCCGCGTTATTCTGCTTGAACTATCCCCAGGTGCATATAACATTTTCTATATGCCCGTTAGTAGCGGGGTCAATTACTTGCTCCGACCAGGGCGTGGCATGCTTTCGCCAGTGCGAATATTAGTTGGGGATTGCCAGTACGCGCCATCGTTGGCAATCGTAGGGGTAAGCTCCTAAAGGGTGGCTCTGCCAGACGGGCGTTGGAGTTGCACTCCATAGCTACGGAACGGCACAACCATTGAGCCCAGCGAGGTATCTTCTGCCTCCCTGTAATGAAACGATAGGTCTGGGATCCGCTAGTCCCACCGGCACAGTATGGCATCCAAGGAACTTGGATGATGTGTATGATGTTCTTTCAGACAGGGAGTACGGGGGATCAGAAGGAGACACCATGCATGCCACACTTTTGCTGGTTGAGAGTCGGCATCACTAGATCGCGAGGGGCCGTCCCGCAATACCGAACAGCATTACTGGAATAGACGTATGCTGGTCACCTGGCCAATTTCGCTATTATTCAATCGACTCTTGAAGCGCTAATAGGCGAATGTGTCTACATGGGGGGTGTTGAGCATTGACATCAATCTTACCACCACGTTTTATTGCGAGAATGCCTTCCCCCAGACGTATGCGTTATTAGAGGCCGACTGACAACACAGTCACTGAATTGCCGTGGGGCCCACGAAAAACGCTGATCAATAATTGTTCTCTGTTCCATCACCTAGAAATTCGTTCGCGGGTCACTCGCCTCAGGAAAGGGCTGGTCCAGCACGTTTTTTCGCACGGAGCCGATTGTGAATTCATGTAGTGCCCGTCCGGGTGTCTAGGATTCTAGTATAGTGAAAATTCCTGTTTAGGGTCTCTATGTTGTTGTACTCGTGATTTCTAGAACTGTTCATCTTGCGTCAGTCCTGCAGTGTCCGCTGTAGCTGAAGATAGTGTTACTGTGCTACTTCTTTCTACCTCTAATGTGAAGCGTCCACCACAGCATTTTTGATGTGGGACATCGAGAGATACGGGTGTGCGCATCGAAGAGCTACTCTTGTTAACGAAACGGATGCTCCAGGAAATTAGACAGAACCACTAGCGGCTGCATGAGAGAGTGGTTGGCTGCGAGTTCATAGTTTGTACGTATTCTGAGCACAACTTGGCTCCTCCCGCTGTACAAATACCAATTATCTTTTCCCATTCCGTACACACATGCACTAATCACTCTTGCTGCGATAGACGCTCATTAGTCGTCTCGACCACACAACCGATCATCTATTCGCCTGGTCTTGGTAGTTCACTCTGAACGTTTATGGTCCAATAAACGCACTCCCTCCTAGGACCTAATGCCATAGATGTGCTTGTCTCGAATAGACAGACGATCGCAGACCAGAACCCGCGAGGCATCCCACTAAGGAAGTTGATGATCGAGTGTGTGCGGAGAGTTGTTGCCGTACAAACCTAGCCGACACCACTTTTAGCAGTCAGCAGGGGATAAATAACAGCTATGTGGCCCTGTGGAAGTTTAGTTTTGAGGGCGCTACCCGTACGATAATGCGGCAGCTTTAATTGATGCTAGTACACTCATGCGGACGGATTGCTATAACCAATCCGGGCCACATGGCTAAACCTGTTCGGAATCACATTGGGGGTTCTTTCAAGCCAGCCGAATAATACAGGGTAAGCCAGTTTTCCGCAGGACGTGCCACGTAATAGGGAAAAGTCAAATGCATATTATATAACACGGGCTCTGATCCGCCACTAAAGCGAATGTCACCCGACCCGTCAGAATTGCCCGAGCAGATTATGTAAGTTCTGGAATTTTCTGCGGCTCTACGACGTACCTGCAGTGGTTTACCAGTCATCCTCCTTGCGGGATGGGCACTAGACCCACAGCGCGTGAGGTGCAATTACAGACGCCTCGGAACCAGGGTTAGCCTTCGAGTATGCCCGAGGTAAACTTCCGTATAGGGCAGCGCGGTAGCGTTTGGCGGTAGGAATTCTAGTACACTAGACAGCCCGTTGACATCCTTTATAATCGCT

Creative Commons License
This work is released into public domain under the CC0 license.